Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6028491
End position: 6028514
Length: 24

DNA sequence
>NC_018266, from 6028491 to 6028514 (24 bp); Amycolatopsis mediterranei S699 ACCGCGGCCGCGACCGGGCCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6027732-6028844	Sequence	AMES_5357 - glycosyl transferase (Protein is coded in complementary strand; from 6028844 to 6027732)