Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6018890
End position: 6018913
Length: 24

DNA sequence
>NC_018266, from 6018890 to 6018913 (24 bp); Amycolatopsis mediterranei S699 CCAGCAGCAGCATCAGCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6018565-6019374	Sequence	AMES_5350 - ABC transporter (Protein is coded in complementary strand; from 6019374 to 6018565)