Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 6014202
End position: 6014228
Length: 27

DNA sequence
>NC_018266, from 6014202 to 6014228 (27 bp); Amycolatopsis mediterranei S699 CGTCGAGGCCGTCGAGGCCGTCGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6013535-6014737	Sequence	AMES_5346 - glycosyl transferase (Protein is coded in complementary strand; from 6014737 to 6013535)