Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5928880
End position: 5928909
Length: 30

DNA sequence
>NC_018266, from 5928880 to 5928909 (30 bp); Amycolatopsis mediterranei S699 CGCGCCAGCCCGCGCCCGACCGCGCCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5928586-5929356	Sequence	AMES_5275 paaG enoyl-CoA hydratase/isomerase (Protein is coded in complementary strand; from 5929356 to 5928586)