Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5908348
End position: 5908371
Length: 24

DNA sequence
>NC_018266, from 5908348 to 5908371 (24 bp); Amycolatopsis mediterranei S699 CGCCGGGCCGCCGGGCAGCCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5908097-5909014	Sequence	AMES_5260 htrB lipid A biosynthesis lauroyl acyltransferase (Protein is coded in complementary strand; from 5909014 to 5908097)