Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5901205
End position: 5901234
Length: 30

DNA sequence
>NC_018266, from 5901205 to 5901234 (30 bp); Amycolatopsis mediterranei S699 GCGCGCCAGCGCGGGCGAGCGCGGGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5900573-5901556	Sequence	AMES_5252 - ArsR family transcriptional regulator (Protein is coded in complementary strand; from 5901556 to 5900573)