Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5817013
End position: 5817036
Length: 24

DNA sequence
>NC_018266, from 5817013 to 5817036 (24 bp); Amycolatopsis mediterranei S699 ACCGCCGCCGCCACCGGCCCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5816660-5818723	Sequence	AMES_5175 - hypothetical protein (Protein is coded in complementary strand; from 5818723 to 5816660)