Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5769980
End position: 5770039
Length: 60

DNA sequence
>NC_018266, from 5769980 to 5770039 (60 bp); Amycolatopsis mediterranei S699 GGCGTGGTCGTCGGGGTGGTGGTCGTCTGGGTCGGCGTCGTCGGGGTCGTGGTCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5768651-5770426	Sequence	AMES_5129 - cellulose 1,4-beta-cellobiosidase (Protein is coded in complementary strand; from 5770426 to 5768651)