Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 57406
End position: 57429
Length: 24

DNA sequence
>NC_018266, from 57406 to 57429 (24 bp); Amycolatopsis mediterranei S699 CTGCGGCTGCTGCTGCGGCTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 57338-58825	Sequence	AMES_0051 ftsW cell division protein FtsW (Protein is coded in complementary strand; from 58825 to 57338)