Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5733033
End position: 5733092
Length: 60

DNA sequence
>NC_018266, from 5733033 to 5733092 (60 bp); Amycolatopsis mediterranei S699 TCGTCGTGGTCGTCGGTGTCGTGGTCGTCGTCTTCGAGCTCGTCGTGGTCGGGGACGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5733014-5734588	Sequence	AMES_5106 - chaperone protein DnaK-like protein (Protein is coded in complementary strand; from 5734588 to 5733014)