Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5626078
End position: 5626122
Length: 45

DNA sequence
>NC_018266, from 5626078 to 5626122 (45 bp); Amycolatopsis mediterranei S699 AGGACAGTGCCGGAAGAGACACTGCCGGAAGAGACACTGCCGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5625739-5626929	Sequence	AMES_5005 - ROK family transcriptional regulator (Protein is coded in complementary strand; from 5626929 to 5625739)