Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5556948
End position: 5556971
Length: 24

DNA sequence
>NC_018266, from 5556948 to 5556971 (24 bp); Amycolatopsis mediterranei S699 CGAGGCCCAGGCCGAGGGCGAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5556512-5557087	Sequence	AMES_4966 pheS phenylalanyl-tRNA synthetase alpha chain (Protein is coded in complementary strand; from 5557087 to 5556512)