Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5503422
End position: 5503475
Length: 54

DNA sequence
>NC_018266, from 5503422 to 5503475 (54 bp); Amycolatopsis mediterranei S699 CCGGTCCCTCCTGTGCCGCCGGTCCCTCCTGTGCCGCCGGTCCCCCCGGTACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5502819-5504195	Sequence	AMES_4910 - hypothetical protein (Protein is coded in complementary strand; from 5504195 to 5502819)