Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5428656
End position: 5428679
Length: 24

DNA sequence
>NC_018266, from 5428656 to 5428679 (24 bp); Amycolatopsis mediterranei S699 CGTCGCCGGCGCCGCCGCCTTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5428219-5428821	Sequence	AMES_4838 - hypothetical protein (Protein is coded in complementary strand; from 5428821 to 5428219)