Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5366596
End position: 5366619
Length: 24

DNA sequence
>NC_018266, from 5366596 to 5366619 (24 bp); Amycolatopsis mediterranei S699 CCGGTGCCGGTTCGGGTGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5364195-5367146	Sequence	AMES_4779 - hypothetical protein (Protein is coded in complementary strand; from 5367146 to 5364195)