Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5357766
End position: 5357789
Length: 24

DNA sequence
>NC_018266, from 5357766 to 5357789 (24 bp); Amycolatopsis mediterranei S699 CTGCTGCTGTTGCTGCTGCTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5356921-5357916	Sequence	AMES_4771 - hypothetical protein (Protein is coded in complementary strand; from 5357916 to 5356921)