Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5341945
End position: 5341971
Length: 27

DNA sequence
>NC_018266, from 5341945 to 5341971 (27 bp); Amycolatopsis mediterranei S699 GGTCGTCGTGGTGGTCGTGGTCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5341025-5342476	Sequence	AMES_4758 abfA alpha-N-arabinofuranosidase (Protein is coded in complementary strand; from 5342476 to 5341025)