Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5325208
End position: 5325231
Length: 24

DNA sequence
>NC_018266, from 5325208 to 5325231 (24 bp); Amycolatopsis mediterranei S699 GCGGCACCGGCAGCCGCACCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5320509-5327930	Sequence	AMES_4745 - non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 5327930 to 5320509)