Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5255743
End position: 5255766
Length: 24

DNA sequence
>NC_018266, from 5255743 to 5255766 (24 bp); Amycolatopsis mediterranei S699 CGACGTCGAGGTCGCCGTCGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5251845-5266841	Sequence	AMES_4708 - non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 5266841 to 5251845)