Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 5123742
End position: 5123771
Length: 30

DNA sequence
>NC_018266, from 5123742 to 5123771 (30 bp); Amycolatopsis mediterranei S699 CGGCGGCGGAGGCGGCCGAGGCGGCGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5123495-5124481	Sequence	AMES_4584 mdh malate dehydrogenase (Protein is coded in complementary strand; from 5124481 to 5123495)