Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 497829
End position: 497855
Length: 27

DNA sequence
>NC_018266, from 497829 to 497855 (27 bp); Amycolatopsis mediterranei S699 GGTCGACCAGGTCGACCAGGTCGTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 497312-498118	Sequence	AMES_0483 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 498118 to 497312)