Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4760091
End position: 4760126
Length: 36

DNA sequence
>NC_018266, from 4760091 to 4760126 (36 bp); Amycolatopsis mediterranei S699 AGGACGGCCGCGGGGACGGCGGCGAGGACGGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4760031-4760846	Sequence	AMES_4292 - sugar ABC transporter permease (Protein is coded in complementary strand; from 4760846 to 4760031)