Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4758328
End position: 4758351
Length: 24

DNA sequence
>NC_018266, from 4758328 to 4758351 (24 bp); Amycolatopsis mediterranei S699 GCCGCAGCCGCTCCCGCAGGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4758009-4760012	Sequence	AMES_4290 yicI family 31 glucosidase (Protein is coded in complementary strand; from 4760012 to 4758009)