Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4674215
End position: 4674238
Length: 24

DNA sequence
>NC_018266, from 4674215 to 4674238 (24 bp); Amycolatopsis mediterranei S699 CGGCGTCGACGTCGGCGCCGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4674079-4675557	Sequence	AMES_4213 - HAD family hydrolase (Protein is coded in complementary strand; from 4675557 to 4674079)