Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4664747
End position: 4664782
Length: 36

DNA sequence
>NC_018266, from 4664747 to 4664782 (36 bp); Amycolatopsis mediterranei S699 GAGGTCGGTGCGGACGTGGGTGCGGAGGTCGGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4664351-4665337	Sequence	AMES_4199 - copper binding protein of plastocyanin/azurin family (Protein is coded in complementary strand; from 4665337 to 4664351)