Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4658033
End position: 4658062
Length: 30

DNA sequence
>NC_018266, from 4658033 to 4658062 (30 bp); Amycolatopsis mediterranei S699 CCGCGGCCGCGGCCGGGGCGGCGGCAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4657512-4658885	Sequence	AMES_4193 - serine/threonine protein kinase (Protein is coded in complementary strand; from 4658885 to 4657512)