Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4542129
End position: 4542152
Length: 24

DNA sequence
>NC_018266, from 4542129 to 4542152 (24 bp); Amycolatopsis mediterranei S699 CCGTCGCCGTCCCGGTCGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4541664-4543700	Sequence	AMES_4076 - glycogen debranching enzyme (Protein is coded in complementary strand; from 4543700 to 4541664)