Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4504387
End position: 4504434
Length: 48

DNA sequence
>NC_018266, from 4504387 to 4504434 (48 bp); Amycolatopsis mediterranei S699 GGGCGTGGTGGTGGTCGTGGTCGTGGTCGTGGGGGTGGTCGTGGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4503452-4504849	Sequence	AMES_4049 - endoglucanase (Protein is coded in complementary strand; from 4504849 to 4503452)