Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4497507
End position: 4497560
Length: 54

DNA sequence
>NC_018266, from 4497507 to 4497560 (54 bp); Amycolatopsis mediterranei S699 GTCGACGTGGTGGGAGTCGTCGGCGTGGTCGGAGACGTCGGCGTTGTCGGAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4497195-4498523	Sequence	AMES_4044 - cellulose-binding protein (Protein is coded in complementary strand; from 4498523 to 4497195)