Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4477943
End position: 4477966
Length: 24

DNA sequence
>NC_018266, from 4477943 to 4477966 (24 bp); Amycolatopsis mediterranei S699 CCGCGGCCACGGCGGCGGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4477672-4477992	Sequence	AMES_4024 - lycopene cyclase (Protein is coded in complementary strand; from 4477992 to 4477672)