Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4452377
End position: 4452400
Length: 24

DNA sequence
>NC_018266, from 4452377 to 4452400 (24 bp); Amycolatopsis mediterranei S699 CACCAGCGCCAGGACCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4452054-4453376	Sequence	AMES_4011 - major facilitator transporter (Protein is coded in complementary strand; from 4453376 to 4452054)