Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4361292
End position: 4361345
Length: 54

DNA sequence
>NC_018266, from 4361292 to 4361345 (54 bp); Amycolatopsis mediterranei S699 GGGCGTGGTCGGCGTGGTGGGGGTCGTCGGCGTGGTCGGCGTCGTCGGGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4360951-4362294	Sequence	AMES_3943 - endoglucanase (Protein is coded in complementary strand; from 4362294 to 4360951)