Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 435472
End position: 435507
Length: 36

DNA sequence
>NC_018266, from 435472 to 435507 (36 bp); Amycolatopsis mediterranei S699 TGTGGTCGCTTCGGTGGTCGCTCCTGTGGTCGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 434753-436426	Sequence	AMES_0418 - hypothetical protein (Protein is coded in complementary strand; from 436426 to 434753)