Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4255971
End position: 4255994
Length: 24

DNA sequence
>NC_018266, from 4255971 to 4255994 (24 bp); Amycolatopsis mediterranei S699 GAGGACGACGACGAGGGCGAGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4255060-4256277	Sequence	AMES_3864 - hypothetical protein (Protein is coded in complementary strand; from 4256277 to 4255060)