Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4239026
End position: 4239049
Length: 24

DNA sequence
>NC_018266, from 4239026 to 4239049 (24 bp); Amycolatopsis mediterranei S699 CGTCGACGTGGACGACGACGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4238281-4239648	Sequence	AMES_3851 - Peptidase M20 (Protein is coded in complementary strand; from 4239648 to 4238281)