Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 4150131
End position: 4150154
Length: 24

DNA sequence
>NC_018266, from 4150131 to 4150154 (24 bp); Amycolatopsis mediterranei S699 ACCGGGACCGGGGCCGGGATCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4149295-4150218	Sequence	AMES_3765 qor NADPH:quinone reductase and related Zn-dependent oxidoreductase (Protein is coded in complementary strand; from 4150218 to 4149295)