Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 3903753
End position: 3903815
Length: 63

DNA sequence
>NC_018266, from 3903753 to 3903815 (63 bp); Amycolatopsis mediterranei S699 GTGGACTGGAGCTCCTCGTTCGTGGTCTCGAGTTCTTCGTTCGTGGACTGGAGTTCCTCGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3903606-3905114	Sequence	AMES_3551 cheR chemotaxis protein methyltransferase CheR (Protein is coded in complementary strand; from 3905114 to 3903606)