Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 388966
End position: 389001
Length: 36

DNA sequence
>NC_018266, from 388966 to 389001 (36 bp); Amycolatopsis mediterranei S699 GCCACCCGCCGCCGCACCCGCCGCGTCACCCCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 388009-389190	Sequence	AMES_0365 - TraI (Protein is coded in complementary strand; from 389190 to 388009)