Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 3789007
End position: 3789030
Length: 24

DNA sequence
>NC_018266, from 3789007 to 3789030 (24 bp); Amycolatopsis mediterranei S699 GGAGCCGGGGCCGGCGCCGGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3788941-3790107	Sequence	AMES_3452 - CP family cyanate transporter (Protein is coded in complementary strand; from 3790107 to 3788941)