Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 3634345
End position: 3634371
Length: 27

DNA sequence
>NC_018266, from 3634345 to 3634371 (27 bp); Amycolatopsis mediterranei S699 CGGGACCGCCGGGACCGCCGGGACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3633813-3634676	Sequence	AMES_3319 rhtC threonine efflux protein (Protein is coded in complementary strand; from 3634676 to 3633813)