Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 3594840
End position: 3594893
Length: 54

DNA sequence
>NC_018266, from 3594840 to 3594893 (54 bp); Amycolatopsis mediterranei S699 CGTGGTGGGGGTCGTCGGCGTGGTGGGCGTGGTCGTCGGGGTGGTGGTCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3594673-3595851	Sequence	AMES_3282 - glycosyl hydrolase (Protein is coded in complementary strand; from 3595851 to 3594673)