Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 3554191
End position: 3554244
Length: 54

DNA sequence
>NC_018266, from 3554191 to 3554244 (54 bp); Amycolatopsis mediterranei S699 GTTCGGCGTGGTCGGGGTGGTGGGCGTGGTCGGGGTGGTCGGCGTCGTGGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3553898-3555274	Sequence	AMES_3251 xynA endo-1,4-beta-xylanase (Protein is coded in complementary strand; from 3555274 to 3553898)