Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 3520734
End position: 3520757
Length: 24

DNA sequence
>NC_018266, from 3520734 to 3520757 (24 bp); Amycolatopsis mediterranei S699 CGACGCCGACGCCGAAGCCGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3519829-3521841	Sequence	AMES_3220 lig ATP-dependent DNA ligase (Protein is coded in complementary strand; from 3521841 to 3519829)