Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 3472097
End position: 3472132
Length: 36

DNA sequence
>NC_018266, from 3472097 to 3472132 (36 bp); Amycolatopsis mediterranei S699 CCGCGATGATCACCGCGATCACCACCGCGGTGATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3471883-3472377	Sequence	AMES_3173 - hypothetical protein (Protein is coded in complementary strand; from 3472377 to 3471883)