Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 3229440
End position: 3229464
Length: 25

DNA sequence
>NC_018266, from 3229440 to 3229464 (25 bp); Amycolatopsis mediterranei S699 CCGCGGCGCGCCGTGCCGCAGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3229180-3230589	Sequence	AMES_2981 mtrB two-component system histidine kinase (Protein is coded in complementary strand; from 3230589 to 3229180)