Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 3143906
End position: 3143941
Length: 36

DNA sequence
>NC_018266, from 3143906 to 3143941 (36 bp); Amycolatopsis mediterranei S699 TCGACGACCAGGTCGACGACCGGCACGACGACCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3143099-3144292	Sequence	AMES_2898 - hypothetical protein (Protein is coded in complementary strand; from 3144292 to 3143099)