Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 3089619
End position: 3089648
Length: 30

DNA sequence
>NC_018266, from 3089619 to 3089648 (30 bp); Amycolatopsis mediterranei S699 GAGGAGTGGTGAGAAGTGATCAGGAGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3087813-3090899	Sequence	AMES_2854 - signal transduction protein containing NTPase domain