Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 281653
End position: 281676
Length: 24

DNA sequence
>NC_018266, from 281653 to 281676 (24 bp); Amycolatopsis mediterranei S699 CGTCGACGTCCACGACGACGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 280956-282449	Sequence	AMES_0261 - adenylate cyclase (Protein is coded in complementary strand; from 282449 to 280956)