Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 2724499
End position: 2724561
Length: 63

DNA sequence
>NC_018266, from 2724499 to 2724561 (63 bp); Amycolatopsis mediterranei S699 GCAAGCACGCGTGTCGTCCGTTCAGGTACGCGTGTCGTCCGGCTGAGTACGCGTGTCGTCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2724562-2725335	Sequence	AMES_2521 - hydrolase (Protein is coded in complementary strand; from 2725335 to 2724562)