Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 2658884
End position: 2658907
Length: 24

DNA sequence
>NC_018266, from 2658884 to 2658907 (24 bp); Amycolatopsis mediterranei S699 CCGCCACCGCGAACGCCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2658568-2660160	Sequence	AMES_2461 - solute/sodium (Na+) symporter (Protein is coded in complementary strand; from 2660160 to 2658568)